Haplogroup J (Y-DNA)

Haplogroup J
Time of origin	25,000-30,000 years BP
Place of origin	Southwest Asia
Ancestor	IJ
Descendants	J1, J2
Defining mutations	12f2.1, M304, P209, S6, S34, S35

Ads by Tiva

In human genetics, Haplogroup J (previously known as HG9 or Eu9/Eu10) is a Y-chromosome DNA haplogroup. It is defined by the 12f2.1 genetic marker, or the equivalent M304 marker. It evolved in the ancient Near East and was then carried into North Africa, Europe, Central Asia, Pakistan and India.

1 Origins
2 Tree
3 Subclades
- 3.1 J1
- 3.2 J2
- 3.3 J*
4 Mutation
5 Haplotypes
- 5.1 Modal
- 5.2 Famous
6 See also
7 References
8 External links
- 8.1 Phylogenetic tree and Distribution Maps of Y-DNA haplogroup J
- 8.2 Other

Origins

Haplogroup J is believed to have arisen roughly 30,000 years ago in Southwest Asia (31,700±12,800 years ago according to Semino et al.. 2004). It is most closely related to Haplogroup I, as both Haplogroup I and Haplogroup J have mutations in common deriving from Haplogroup IJ (S2, S22). Haplogroup IJ and haplogroup K derive from Haplogroup IJK (L15/S137, L16/S138), and only at this level of classification does haplogroup IJK join with Haplogroup G and Haplogroup H as immediate descendants of Haplogroup F. The main current subgroups J1 and J2, which now comprise between them almost all of the population of the haplogroup, are both believed to have arisen very early, at least 10,000 years ago.

Haplogroup J is found in greatest concentration in Southwest Asia. Outside of this region, haplogroup J has a presence in North Africa. It also has a moderate presence in Southern Europe (especially in central and southern Italy, Malta, Greece, and Albania), Central Asia, and South Asia, particularly in the form of its subclade J2 (J-M172). Haplogroup J is also found in Horn of Africa, particularly in the form of its subclade J1 (J-M267). Subclades J2a and J2a1b1 are found mostly in Greece, Anatolia, and southern Italy.

Tree

Below are the subclades of Haplogroup J with their defining mutation, according to the ISOGG tree (as of March 2010). Note that the descent-based identifiers may be subject to change, as new SNPs are discovered that augment and further refine the tree.

J 12f2.1, M304, P209, S6, S34, S35

J* -
J1 M267
- J1* -
- J1a M62
- J1b M365
- J1c L136
  - J1c1 M390
  - J1c2 P56
  - J1c3 P58
    - J1c3* -
    - J1c3a M367, M368
    - J1c3b M369
    - J1c3c L92, L93
    - J1c3d L147
      - J1c3d* -
      - J1c3d1 L222
        
        J1c3d1* -
        
        J1c3d1a L65.2/S159.2
J2 M172
- J2* -
J2a M410
- - J2a* -
  - J2a1 (not currently in use by ISOGG)
  - J2a2 M340
  - J2a3 P279
  - J2a4 DYS413≤18, L26/S57, L27
    - J2a4* -
    - J2a4a M47, M322
    - J2a4b M67/S51
      - J2a4b* -
      - J2a4b1 M92, M260
        
        J2a4b1* -
        
        J2a4b1a M327
      - J2a4b2 M163, M166
    - J2a4c M68
    - J2a4d M319
    - J2a4e M339
    - J2a4f M419
    - J2a4g P81
    - J2a4h L24
      - J2a4h* -
      - J2a4h1 L25
        
        J2a4h1* -
        
        J2a4h1a DYS445≤7
        
        J2a4h1a* -
        
        J2a4h1a1 L70
        
        J2a4h1a1 -
        
        J2a4h1a1a M137
        
        J2a4h1a1b M289 (location under DYS445≤7 uncertain)
        
        J2a4h1a1c M318
      - J2a4h2 M158 (location under L24 uncertain)
- J2b M12, M102, M221, M314
  - J2b* -
  - J2b1 M205
  - J2b2 M241
    - J2b2* -
    - J2b2a M99
    - J2b2b M280
    - J2b2c M321
    - J2b2d P84
    - J2b2e DYS455≤9

Subclades

J1

Main article: Haplogroup J1 (Y-DNA)

ISOGG states that J1 originated in the Levant region, other parts of the Near East, and North Africa, with a sparse distribution in the southern Mediterranean flank of Europe, and in Ethiopia. But not all studies agree with this conclusion, a recent 2009 study concluded that the haplogroup at a more Northern origin. The origin of J1c3 is likely in the more northerly populations in and then spreads southward into the Arabian Peninsula." The high YSTR variance of J1c3 in Turks and Syrians supports the inference of an origin of J1c3 in nearby eastern Anatolia. Moreover, the network analysis of J1c3 haplotypes shows that some of the populations with low diversity, such as Bedouins from Israel, Qatar, Sudan and UAE, are tightly clustered near high-frequency haplotypes suggesting founder effects with star burst expansion in the Arabian Desert. " ^[1] Haplogroup J1, defined by the 267 marker is most frequent in the Arabian Peninsula Yemen(76%)^[2], Saudi (64%) ^[3], Qatar (58%)^[4], and Dagestan (56%)^[5]. J1 is generally frequent amongst Arab Bedouins (62%^[6]. It is also very common among others such as those of the southern Levant, i.e. Palestinians (38.4%) ^[7], in Algeria (35%)^[7], Iraq (28.2%)^[7], Tunisia (31%)^[8], Syria (30%), Egypt (20%)^[9], and the Sinai Peninsula. The frequency of Haplogroup J1 collapses suddenly at the borders of Arabic speaking countries with mainly non-Arabic speaking countries, such as Turkey (9%) and Iran (9.5%) ^[10]. It is also highly frequent among Jews, especially the Kohanim caste (46%) [1] ^[11] .

J2

Main article: Haplogroup J2 (Y-DNA)

Haplogroup J2 is found in the highest concentrations in the Fertile Crescent and is found throughout the Mediterranean (including Southern Europe and North Africa), the Balkan peninsula, the Caucasus, the Iranian plateau and into Central Asia^[7] and South Asia. More specifically it is found in Iraq, Syria, Lebanon, Turkey, Azerbaijan, Iran, Israel, Greece, Italy, the Balkans and the eastern coasts of the Iberian Peninsula^[12], and most frequently in Lebanese 30% (Wells et al. 2001), Iraqis 29.7% (Sanchez et al. 2005), Syrians 29%, Kurds 28.4%, Iranians 24%^[13], Ashkenazi Jews 24%, Palestinian Arabs 16.8% and Sephardic Jews [2]

Consistent with its Middle Eastern extent, J2 also includes the Cohen Modal Haplotype.

J*

Haplogroup J* includes all of J except for J1 and J2. J* is rarely found outside of the island of Socotra, where it is quite frequent at 71.4%^[14]. Haplogroup J* also has been found with lower frequency in Oman,^[15] Ashkenazi Jews,^[16] Pakistan,^[17] Saudi Arabia,^[18] Greece,^[15] the Czech Republic,^[15]^[19] Mariña Lucense,^[20] and several Turkic peoples.^[5]^[10]^[21]

Mutation

The technical details of M304 are:

Nucleotide change: A to C

Position (base pair): 421

Total size (base pairs): 527

Forward 5′→ 3′: caaagtgctgggattacagg

Reverse 5′→ 3′: cttctagcttcatctgcattgt

Haplotypes

Modal

J Modal Haplotype. Ysearch K23DT

DYS	393	390	19	391	385A	385B	426	388	439	389I	392	389II	458	459A	459B	455	454	447	437	448	449	464A	464B	464C	464D
Alleles	12	23	14	10	14	17	11	16	11	13	11	30	17	8	9	11	11	26	14	20	28	13	14	15	16

J1 Modal Haplotype. Ysearch RR9SS
Ashkenazi Cohen Cluster Ysearch G6839
J2 Modal Haplotype. Ysearch 9EQTH
J2a1b1 (M92) Modal Haplotype. (old J2f1) NFNYH
Comparison

Famous

Main article: Famous haplogroup members

Matt Lauer belongs to Y-DNA haplogroup J.^[22]

References

^ *European Journal of Human Genetics (2010): The emergence of Y-chromosome haplogroup J1c3 among Arabic-speaking populations
^ *Alshamali et al. 2009 81% (84/104) *Malouf et al. 2008: 70% (28/40) *Cadenas et al. 2008: 45/62 = 72.6% J1-M267
^ Alshamali F, Pereira L, Budowle B, Poloni ES, Currat M (2009). "Local population structure in Arabian Peninsula revealed by Y-STR diversity". Hum. Hered. 68 (1): 45–54. doi:10.1159/000210448. PMID 19339785. http://content.karger.com/ProdukteDB/produkte.asp?doi=10.1159/000210448.
^ Cadenas et al. 2008 42/72 = 58.3% J1-M267
^ ^a ^b Yunusbaev et al. 2006:Dargins (91%), Avars (67%), Chamalins (67%), Lezgins (58%), Tabassarans (49%), Andis (37%), Bagvalins (21.4%))stats combined Dagestan ethnic groups see Dagestan article
^ 21/32 Nebel et al. 2001
^ ^a ^b ^c ^d Semino O, Magri C, Benuzzi G, et al. (May 2004). "Origin, diffusion, and differentiation of Y-chromosome haplogroups E and J: inferences on the neolithization of Europe and later migratory events in the Mediterranean area". Am. J. Hum. Genet. 74 (5): 1023–34. doi:10.1086/386295. PMID 15069642. PMC 1181965. http://linkinghub.elsevier.com/retrieve/pii/S0002-9297(07)64366-3.
^ combined (Semino et al. 2004 30%) & (Arredi et al. 2004 32%)
^ Luis JR, Rowold DJ, Regueiro M, et al. (March 2004). "The Levant versus the Horn of Africa: evidence for bidirectional corridors of human migrations". Am. J. Hum. Genet. 74 (3): 532–44. doi:10.1086/382286. PMID 14973781. PMC 1182266. http://linkinghub.elsevier.com/retrieve/pii/S0002-9297(07)61870-9.
^ ^a ^b Cinnioğlu C, King R, Kivisild T, et al. (January 2004). "Excavating Y-chromosome haplotype strata in Anatolia". Hum. Genet. 114 (2): 127–48. doi:10.1007/s00439-003-1031-4. PMID 14586639. http://hpgl.stanford.edu/publications/HG_2004_v114_p127-148.pdf.
^ Hammer, Michael F; Doron M Behar and 7 others (2009-08-08). "Extended Y chromosome haplotypes resolve multiple and unique lineages of the Jewish priesthood". Hum Genet (Springer) epub ahead of publication.
^ Di Giacomo F, Luca F, Anagnou N, et al. (September 2003). "Clinal patterns of human Y chromosomal diversity in continental Italy and Greece are dominated by drift and founder effects". Mol. Phylogenet. Evol. 28 (3): 387–95. doi:10.1016/S1055-7903(03)00016-2. PMID 12927125. http://www.familytreedna.com/pdf/italy.pdf.
^ Y haplogroup J in Iran by Alfred A. Aburto Jr.
^ Viktor Cerny et al. (2008),J*-12f2(xJ1-M267, J2-M172)(45/63)
^ ^a ^b ^c Di Giacomo F, Luca F, Popa LO, et al. (October 2004). "Y chromosomal haplogroup J as a signature of the post-neolithic colonization of Europe". Hum. Genet. 115 (5): 357–71. doi:10.1007/s00439-004-1168-910.1007/s00439-004-1168-9 (inactive 2010-01-09). PMID 15322918. http://www.ftdna.com/pdf/HaploJ.pdf.
^ Shen P, Lavi T, Kivisild T, et al. (September 2004). "Reconstruction of patrilineages and matrilineages of Samaritans and other Israeli populations from Y-chromosome and mitochondrial DNA sequence variation". Hum. Mutat. 24 (3): 248–60. doi:10.1002/humu.2007710.1002/humu.20077 (inactive 2010-01-09). PMID 15300852. Haplogroup J-M304(xJ1-M267, J2-M172) in 1/20 Ashkenazi Jews.
^ Firasat et al. (2007), J*-12f2(xJ1-M267, J2-M172): 1.0% (1/97) "Burusho," 3.0% (19/638) "Pakistan"
^ Khaled K. Abu-Amero, Ali Hellani, Ana M. Gonzalez et al., "Saudi Arabian Y-Chromosome diversity and its relationship with nearby regions," BMC Genetics 2009, 10:59 doi:10.1186/1471-2156-10-59
^ Luca F, Di Giacomo F, Benincasa T, et al. (January 2007). "Y-chromosomal variation in the Czech Republic". Am. J. Phys. Anthropol. 132 (1): 132–9. doi:10.1002/ajpa.2050010.1002/ajpa.20500 (inactive 2010-01-09). PMID 17078035.
^ M.Brion et al." Hierarchical analysis of 30 Y-chromosome SNPs in European populations"," Springer-Verlag (2004)
^ Alexander Varzari, "Population History of the Dniester-Carpathians: Evidence from Alu Insertion and Y-Chromosome Polymorphisms" (2006)
^ Famous Haplogroups, ISOGG

yJdb: the Y-haplogroup J database haplotypes of haplogroup J.
[3]
Haplogroup J subclades at International Society of Genetic Genealogy
Nebel et al. 2001,see hModal Haplotypes of J1 (as Eu10)
Sanchez JJ, Hallenberg C, Børsting C, Hernandez A, Morling N (July 2005). "High frequencies of Y chromosome lineages characterized by E3b1, DYS19-11, DYS392-12 in Somali males". Eur. J. Hum. Genet. 13 (7): 856–66. doi:10.1038/sj.ejhg.5201390. PMID 15756297. http://www.nature.com/ejhg/journal/v13/n7/full/5201390a.html.
Sengupta S, Zhivotovsky LA, King R, et al. (February 2006). "Polarity and temporality of high-resolution y-chromosome distributions in India identify both indigenous and exogenous expansions and reveal minor genetic influence of Central Asian pastoralists". Am. J. Hum. Genet. 78 (2): 202–21. doi:10.1086/499411. PMID 16400607. PMC 1380230. http://linkinghub.elsevier.com/retrieve/pii/S0002-9297(07)62353-2.
Cinnioğlu C, King R, Kivisild T, et al. (January 2004). "Excavating Y-chromosome haplotype strata in Anatolia". Hum. Genet. 114 (2): 127–48. doi:10.1007/s00439-003-1031-4. PMID 14586639. http://hpgl.stanford.edu/publications/HG_2004_v114_p127-148.pdf.

External links

Phylogenetic tree and Distribution Maps of Y-DNA haplogroup J

Y-DNA Haplogroup J and Its Subclades from ISOGG 2009

Other

Human Y-chromosome DNA (Y-DNA) haplogroups (by ethnic groups · famous haplotypes)

most recent common Y-ancestor

IJK

MNOPS

Open source encyclopedia content modification information:

This page was last modified on 19 March 2010 at 12:48.

Authorship and Review

Open source encyclopedia content provided here is not reviewed directly by MedLibrary.org. Content is sourced directly from Wikipedia and is authored by an open community of volunteers. It is not produced by or in any way affiliated with MedLibrary.org.

Usage Guidelines

This article is licensed under the GNU Free Documentation License. It uses material from the Wikipedia article on "Haplogroup J (Y-DNA)", which is available in its original form here:

http://en.wikipedia.org/w/index.php?title=Haplogroup_J_(Y-DNA)

All material adapted used from Wikipedia is available under the terms of the GNU Free Documentation License. Wikipedia® itself is a registered trademark of the Wikimedia Foundation, Inc.

Haplogroup J (Y-DNA) -- Please Click to Return to Front Page